View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5547_low_3 (Length: 388)
Name: NF5547_low_3
Description: NF5547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5547_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 51 - 325
Target Start/End: Original strand, 38760355 - 38760629
Alignment:
| Q |
51 |
gtacaatcttgcatgagatatttactggttcgtcgatcaatatttctccaccataaccatcacatttgttttaagatgataaaatcatacaatgtgaagt |
150 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38760355 |
gtacaatcttgcacgagatatttactggttcgtcgatcaataattctccaccataaccatcacatttgttttaagatgataaaatcatacaaagtgaagt |
38760454 |
T |
 |
| Q |
151 |
gcatgttctgaaagattgtacgaacttttgcatattttgagtgcatatgcaaagctcgaatctgttttagctcttttctcttctggcagtagcttcaaag |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38760455 |
gcatgttctgaaagattgtacgaacttttgcatattttgagtgcatatggaaatctcgaatctgttttagctcttttctcttctggcagtagcttcaaag |
38760554 |
T |
 |
| Q |
251 |
gaagaacatggtacactttacagggaaaatttacgtaacaaaacnnnnnnnnncccacatgaaaaaacctctttt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38760555 |
gaagaacatggtacactttacagggaaaatttacgtaacaaaactttttttttcccacatgaaaaaacctctttt |
38760629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University