View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5547_low_5 (Length: 300)
Name: NF5547_low_5
Description: NF5547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5547_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 119 - 282
Target Start/End: Original strand, 16992525 - 16992689
Alignment:
| Q |
119 |
tcgttaacaagacctttattctataaaatagcttgaaaaattgaatatgtaccc--cgctttgtgtatgatatcttatctatagtcaatcttcaaataaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||| | |||||||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
16992525 |
tcgttaacaagacctttattctataaaatagcttgaaaatttgaatatataccctccactttgtgtgtgata-catatctatagtcaatcttcaaataaa |
16992623 |
T |
|
| Q |
217 |
tgctaataagagtggtccctatatcaaaattaaagacaaccaactaactactaaaatttggatacc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16992624 |
tgctaataagagtggtccctatatcaaaattaaagacaaccaactaactactaaaatttggatacc |
16992689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University