View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5547_low_9 (Length: 230)
Name: NF5547_low_9
Description: NF5547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5547_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 5432076 - 5431843
Alignment:
| Q |
1 |
ttatgatttgttgttgtagtgatgtgctagatcttttaggttgaagagtaatctaagtttcctttttctctcatgaaaatgttagcttcaattcctannn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5432076 |
ttatgatttgttgttgtagtgatgtgctagatcttttaggttgaagagtaatctaagtttcctttttctctcatgaaaatgttagcttcaattcctattg |
5431977 |
T |
|
| Q |
101 |
nnnnn----------aaatggtcaaagttaataatttagttgttaggttaatatttttatcattcaccgggtttgaaccgggggtcctcaagttccttta |
190 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5431976 |
tttttttttttttttaaatggccaaagttaataatttagttgttaggttagtatttttatcattcaccgggtttgaaccgggagtcctcaagttccttta |
5431877 |
T |
|
| Q |
191 |
acctttagctcaaaaaagttgttaggttagtatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5431876 |
acctttagctcaaaaaagttgttaggttagtatt |
5431843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 128 - 211
Target Start/End: Complemental strand, 5431860 - 5431778
Alignment:
| Q |
128 |
agttgttaggttaatatttttatcattcaccgggtttgaaccgggggtcctcaagttcctttaacctttagctcaaaaaagttg |
211 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||| |||||||||||||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
5431860 |
agttgttaggttagtatttttttcactcaccaggtttgaaccgggg-tcctcaagttcctttgacctttagctcaaaacagttg |
5431778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University