View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5548-Insertion-1 (Length: 382)
Name: NF5548-Insertion-1
Description: NF5548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5548-Insertion-1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 36 - 297
Target Start/End: Original strand, 42240468 - 42240729
Alignment:
| Q |
36 |
gcttgtttgatgttgtcagcttcttgaaggtttagctttcaaatatagtcacgatgacaaggacacatttttggtcttaacttaggggggtggtatatat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42240468 |
gcttgtttgatgttgtcagcttcttgaaggtttagctttcaaatatagtcacgatgacaaggacacatttttggtcttaacttaggggggtggtatatat |
42240567 |
T |
 |
| Q |
136 |
ctgcatatataaattgattgaatataagaaaagaggctgctttcgttggtggttggagttggtatagaaaatggttttgtataggagatgagatggctcc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42240568 |
ctgcatatataaattgattgaatataagaaaagaggctgctttcgttggtggttggagttggtatagaaaatggttttgtataggagttgagatggctcc |
42240667 |
T |
 |
| Q |
236 |
ttcattgaagtaggtgactttcaaacattgaactaaaattagagaaagagttagtttggctg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42240668 |
ttcattgaagtaggtgactttcaaacattgaactaaaattagagaaagagttagtttggctg |
42240729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University