View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5548_high_2 (Length: 291)
Name: NF5548_high_2
Description: NF5548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5548_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 32220371 - 32220113
Alignment:
| Q |
19 |
taaagggatggcaaattcaatgtccttattaattaatcaagatgctatttcatttgaataagcctccaacagtctttttaacaccatcaagcacacctgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32220371 |
taaagggatggcaaattcaatgtccttattaattaatcaagatgctatttcatttgaataagcctccaacagtctttttaacaccatcaagcacaccagc |
32220272 |
T |
 |
| Q |
119 |
ttcttcggttttggcaggctccgcaggtttggaatgaacataatcagcagccctatcaatttgctctacaactgtcttcttaacaccctctgcagcagtt |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32220271 |
ttcttcggttttggcaggctccacaggtttagaatgaacataatcagcagccctatcaatttgctctacaactgtcttcttaacaccctctgcagcagtt |
32220172 |
T |
 |
| Q |
219 |
gctaccttttcaccttgtttcaccacagttgtctgtgctgattctgctgccacctttgc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32220171 |
gctaccttttcaccttgtttcaccacagttgtctgtgctgattctgctgccacctttgc |
32220113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 66 - 277
Target Start/End: Complemental strand, 32218683 - 32218472
Alignment:
| Q |
66 |
tttcatttgaataagcctccaacagtctttttaacaccatcaagcacacctgcttcttcggttttggcaggctccgcaggtttggaatgaacataatcag |
165 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||| | ||||||| | ||| |||||||||||| ||||| |
|
|
| T |
32218683 |
tttcatttgaataagcctccaacagcttttttaacaccatcaagcacaccaccttcttcggatttaggaggctcctctggtgtggaatgaacatgatcag |
32218584 |
T |
 |
| Q |
166 |
cagccctatcaatttgctctacaactgtcttcttaacaccctctgcagcagttgctaccttttcaccttgtttcaccacagttgtctgtgctgattctgc |
265 |
Q |
| |
|
||||||| |||| ||||| || || ||||||||| | ||||||||||||||| ||||| ||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
32218583 |
cagccctgtcaacgtgctcaactacggtcttcttagccttctctgcagcagttgccaccttctcagattgttgccccacagttgtctgtgctgattctgc |
32218484 |
T |
 |
| Q |
266 |
tgccacctttgc |
277 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32218483 |
tgccacctttgc |
32218472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University