View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5548_low_1 (Length: 345)
Name: NF5548_low_1
Description: NF5548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5548_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 11 - 334
Target Start/End: Complemental strand, 1248373 - 1248050
Alignment:
| Q |
11 |
caaagggagaacaaatcaagaacaagaccaaattacttggcttgttctcccacattgtacatttattaataataatcattgaaaatgggcaactgtgctg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248373 |
caaagggagaacaaatcaagaacaagaccaacttacttggcttgttctcccacattgtacatttattaataataatcattgaaaatgggcaactgtgctg |
1248274 |
T |
 |
| Q |
111 |
gcaaccctaggaccgacgaaagtgacgctccagtccctgtccccgagcctgtcaccgaggaggttaaggttgaacagcaagccaaggagaccaaagctga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248273 |
gcaaccctaggaccgacgaaagtgacgctccagtccctgtccctgagcctgtcaccgaggaggttaaggttgaacagcaagccaaggagaccaaagctga |
1248174 |
T |
 |
| Q |
211 |
ggagaccgttaaggcctccgacgataagtctctaggcaccttgctcagtgaggtatgtattcttatataagcaatcatattcatgcacataaatccgata |
310 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1248173 |
ggagaccgttaaggcctctgacgataagtctctaggcaccttgctcagtgaggtatgtattcttatataagcaatcatattcatgcacataaatccgata |
1248074 |
T |
 |
| Q |
311 |
ttgaatatccaacaccatatagtt |
334 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1248073 |
ttgaatatccaacaccatatagtt |
1248050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University