View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5549_high_18 (Length: 228)
Name: NF5549_high_18
Description: NF5549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5549_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 153
Target Start/End: Original strand, 32163142 - 32163281
Alignment:
| Q |
14 |
cacagacacatgggcaatttgcatagatgagacattttttgcggaattgtagaaaatggaagtcttatagcattttgatttgcattccgatttgattgaa |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32163142 |
cacatacacatgggcaatttgcatagatgagacattttttgcggaattgtagaaaatggaagtcttatagcattttgatttacattccgatttgattgaa |
32163241 |
T |
 |
| Q |
114 |
tatattgatcataggttaaagtaattgttaagatatatga |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163242 |
tatattgatcataggttaaagtaattgttaagatatatga |
32163281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 210
Target Start/End: Original strand, 32163293 - 32163330
Alignment:
| Q |
173 |
atatatagaaattgtaagatatatgtgatatgccctct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163293 |
atatatagaaattgtaagatatatgtgatatgccctct |
32163330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University