View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5549_high_20 (Length: 219)
Name: NF5549_high_20
Description: NF5549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5549_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 17 - 144
Target Start/End: Original strand, 32163154 - 32163281
Alignment:
| Q |
17 |
ggcaatttgcatagatgagacattttttgcggaattgtagaaaatggaagtcttatagcattttgatttgcattccgatttgattgaatatattgatcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32163154 |
ggcaatttgcatagatgagacattttttgcggaattgtagaaaatggaagtcttatagcattttgatttacattccgatttgattgaatatattgatcat |
32163253 |
T |
 |
| Q |
117 |
aggttaaagtaattgttaagatatatga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32163254 |
aggttaaagtaattgttaagatatatga |
32163281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 32163293 - 32163330
Alignment:
| Q |
164 |
atatatagaaattgtaagatatatgtgatatgccctct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163293 |
atatatagaaattgtaagatatatgtgatatgccctct |
32163330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University