View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5549_high_9 (Length: 351)
Name: NF5549_high_9
Description: NF5549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5549_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 53 - 313
Target Start/End: Complemental strand, 36957312 - 36957052
Alignment:
| Q |
53 |
ctgttttttcttccgtgctctacaaattttaggcctcgtatttctgtgccaatgttctgtagtagaggcattattgtgatattggcttggttgttttt-c |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
36957312 |
ctgttttttcttccgtgctctacaaattttaggcctcatatttctgtgccaatgttctgtagtagaggcattattgtgatattggcttgggtgttttttc |
36957213 |
T |
 |
| Q |
152 |
aaatttaaataactcaaaaaatgaggagaaactttaacaaaatgataatttcaggtcacaaaagaaaaaagtgttatgcttgcatgatagaaagttagtt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36957212 |
aaatttaaataactcaaaaaatgaggagaaactttaacaaaatgataatttcaggtcacaaa-gaaaaaagtgttatgcttgcatgatagaaagttagtt |
36957114 |
T |
 |
| Q |
252 |
ctaccccaaagtacacaaccacagttcaatttccgaccaagattattagtgagtcgaaacaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36957113 |
ctaccccaaagtacacaaccacagttcaatttccgaccaaaattattagtgagtcgaaacaa |
36957052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University