View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5549_low_18 (Length: 234)
Name: NF5549_low_18
Description: NF5549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5549_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 12922096 - 12922315
Alignment:
| Q |
1 |
ctatgcatgaatgaacattctgttttcattgaaaattctgttatcatattttgagtacatccagtgaaccaaccatgagacaaaatgtatggtttgcaaa |
100 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12922096 |
ctatgcatgaatgaaaattctgttatcattgaaaattctgttatcatattttgagtacatccagtgaaccaaccatgagacaaaatgtatggtttgcaaa |
12922195 |
T |
|
| Q |
101 |
gaaaacacataattatgcaacttaatttaatcatattcaaacttgcatgcttgtcttaagtggtccaaattgtaaaatcacatcaactgttcattaatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12922196 |
gaaaacacataattatgcaacttaatttaatcatattcaaacttgcatgcttgtcttaagtggtccaaattgtaaaatcacatcaactgttcattaatca |
12922295 |
T |
|
| Q |
201 |
attggttggatgcaagttat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12922296 |
attggttggatgcaagttat |
12922315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University