View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5549_low_20 (Length: 228)
Name: NF5549_low_20
Description: NF5549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5549_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 211
Target Start/End: Original strand, 3567376 - 3567576
Alignment:
| Q |
14 |
attattctcacatttgcataaacaagcgtgttccaaaagagtgacaaagtaagttttgagtgttattaaaaagatcaattgcatcatctaattaatatt- |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
3567376 |
attattctcacatttgcataaacaagcgtgttccaaaagagtgacagagtaagttttgagtgttattaaaaaaatcaattgcatcatctaattaacattt |
3567475 |
T |
 |
| Q |
113 |
--atataagttatttttaactttgcatttatgataatgagaattaaccaatggttaataaagttaatttagtctttatcttttacaaaaacacgtgtttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
3567476 |
ttatataagttatttttaactttgcatttatgataatgagaattaaccaatggttaataaagttaatttagtctctatcttttacaaaaacatgtgtttt |
3567575 |
T |
 |
| Q |
211 |
t |
211 |
Q |
| |
|
| |
|
|
| T |
3567576 |
t |
3567576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 153
Target Start/End: Original strand, 33177651 - 33177684
Alignment:
| Q |
120 |
ttatttttaactttgcatttatgataatgagaat |
153 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
33177651 |
ttatttttaactttgcatttatgataataagaat |
33177684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 149
Target Start/End: Original strand, 35689969 - 35689998
Alignment:
| Q |
120 |
ttatttttaactttgcatttatgataatga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35689969 |
ttatttttaactttgcatttatgataatga |
35689998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University