View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5549_low_21 (Length: 219)

Name: NF5549_low_21
Description: NF5549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5549_low_21
NF5549_low_21
[»] chr8 (2 HSPs)
chr8 (17-144)||(32163154-32163281)
chr8 (164-201)||(32163293-32163330)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 17 - 144
Target Start/End: Original strand, 32163154 - 32163281
Alignment:
17 ggcaatttgcatagatgagacattttttgcggaattgtagaaaatggaagtcttatagcattttgatttgcattccgatttgattgaatatattgatcat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
32163154 ggcaatttgcatagatgagacattttttgcggaattgtagaaaatggaagtcttatagcattttgatttacattccgatttgattgaatatattgatcat 32163253  T
117 aggttaaagtaattgttaagatatatga 144  Q
    ||||||||||||||||||||||||||||    
32163254 aggttaaagtaattgttaagatatatga 32163281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 32163293 - 32163330
Alignment:
164 atatatagaaattgtaagatatatgtgatatgccctct 201  Q
    ||||||||||||||||||||||||||||||||||||||    
32163293 atatatagaaattgtaagatatatgtgatatgccctct 32163330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University