View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5549_low_23 (Length: 215)

Name: NF5549_low_23
Description: NF5549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5549_low_23
NF5549_low_23
[»] chr6 (1 HSPs)
chr6 (19-102)||(5444460-5444543)


Alignment Details
Target: chr6 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 5444460 - 5444543
Alignment:
19 aatgacaccaagcaacttgcagcttggtctttctcttaacttgtatggactaatttgctagtaagcgatataatttaaggacta 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5444460 aatgacaccaagcaacttgcagcttggtctttctcttaacttgtatggactaatttgctagtaagcgatataatttaaggacta 5444543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University