View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5551_low_5 (Length: 323)
Name: NF5551_low_5
Description: NF5551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5551_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 17 - 301
Target Start/End: Complemental strand, 6335921 - 6335625
Alignment:
| Q |
17 |
tccaagaagtataacacaccgttcataatttatagaaaattgatctcacgcaccaaaaaattaccttaataccccaaccagcagttaaatgttgtaggag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6335921 |
tccaagaagtataacacaccgttcataatttatagaaaattgatctcacgcaccaaaaaattaccttaataccccaaccagcagttaaatgttgttggag |
6335822 |
T |
 |
| Q |
117 |
attttg------------gatacgtaagagcaatttcagaagcttaaatagcaataccctaatttatatccctccatgcaatggtaatatcaggcttcac |
204 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6335821 |
attttgaaggtaattttggatacgtaagagcaatttcagaagcttaaatagcaataccctaatttatatccctccatgcaatggtaatataaggcttcac |
6335722 |
T |
 |
| Q |
205 |
gtcagctaggcttccaatttccaaagccaatttgccacaccgtgtcttcaaactacatcccccttttatttctatatatgtaggacatctagagtca |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6335721 |
gtcagctaggcttccaatttccaaagccaatttgccacaccgtgtcttcaaactacaccccccttttatttctatatatgtaggacatctagagtca |
6335625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University