View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5552-Insertion-14 (Length: 118)
Name: NF5552-Insertion-14
Description: NF5552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5552-Insertion-14 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 2e-56; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 118
Target Start/End: Original strand, 25515351 - 25515461
Alignment:
| Q |
8 |
gttagacaatcacacacctcccacttttcatggtgttgactctaacacttttattgtgatggtcaatgaatgcttcaagcttggtaaggttgatgaagcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25515351 |
gttagacaatcacacacctcccacttttcatggtgttgactctaacacttttattgtgatggtcaatgaatgcttcaagcttggtaaggttgatgaagcc |
25515450 |
T |
|
| Q |
108 |
cttgcaacttt |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
25515451 |
cttgcaacttt |
25515461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 5e-35
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 25535097 - 25534987
Alignment:
| Q |
8 |
gttagacaatcacacacctcccacttttcatggtgttgactctaacacttttattgtgatggtcaatgaatgcttcaagcttggtaaggttgatgaagcc |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| ||||| ||||||||||| |||||||| |||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25535097 |
gttagacaatcatacacctcccacttttcatgctgtcaactctgacacttttattttgatggtcgatgaatgcttgaagcttggtaagattgatgaagcc |
25534998 |
T |
|
| Q |
108 |
cttgcaacttt |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
25534997 |
cttgcaacttt |
25534987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 25527065 - 25526955
Alignment:
| Q |
8 |
gttagacaatcacacacctcccacttttcatggtgttgactctaacacttttattgtgatggtcaatgaatgcttcaagcttggtaaggttgatgaagcc |
107 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||| |||||| ||||||||| | |||||||| | |||||||| ||||| |||||||||||||||||| |
|
|
| T |
25527065 |
gttagacaatcacacgccttccacttttcatggtgtcgactctgacacttttactttgatggtcgaggaatgcttgaagctcggtaaggttgatgaagcc |
25526966 |
T |
|
| Q |
108 |
cttgcaacttt |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
25526965 |
cttgcaacttt |
25526955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University