View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5552_high_20 (Length: 202)
Name: NF5552_high_20
Description: NF5552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5552_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 41035221 - 41035391
Alignment:
| Q |
13 |
aagaatataagaaacagagagaaaattagatattaaatgaatgccgaaaagttagatgagcacaaatgtaagagctcaatcaaaaaattagtatttgtgg |
112 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
41035221 |
aagaaaataagaaactgagagaaaattagatat-----gaatgccgaaaagttagatgagcacaaatgtaagagctcaatcaaagaattagtatttatgg |
41035315 |
T |
|
| Q |
113 |
ctccgtgcgatgcaacaaatttagatcaaggacacctgttttattgcaaagaatgaaagaagaaaagaaaatattg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41035316 |
ctccgtgcgatgcaacaaatttagatcaacgacacctgttttattgcaaagaatgagagaagaaaagaaaatattg |
41035391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University