View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5552_low_17 (Length: 244)
Name: NF5552_low_17
Description: NF5552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5552_low_17 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 25472167 - 25472091
Alignment:
| Q |
18 |
tattgatgatgggacaattggtgaaagcaatgatgttgatatatcacttgatattccatctgatttacttatatcaa |
94 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25472167 |
tattgatgatggaacagttggtgaaataaatgacgtagatatatcacttgatattccatctgatttacttatatcaa |
25472091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 22 - 101
Target Start/End: Complemental strand, 8211 - 8132
Alignment:
| Q |
22 |
gatgatgggacaattggtgaaagcaatgatgttgatatatcacttgatattccatctgatttacttatatcaagtaatga |
101 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| || ||| | ||| ||||||||||||||||||| ||||| |
|
|
| T |
8211 |
gatgatgggacaattggtgaaagcaataatgttgatatcacaattggtgttctgcctgatttacttatatcaagcaatga |
8132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 120 - 177
Target Start/End: Original strand, 25069 - 25126
Alignment:
| Q |
120 |
ttatatgttggatttaattctaagtgaagcaaaactttatttgagtcatgattcgccg |
177 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||| | ||| ||||| ||||||||||| |
|
|
| T |
25069 |
ttatatgttggatttgattccaggtgaagcaaaaatgtatctgagttatgattcgccg |
25126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University