View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5552_low_18 (Length: 237)
Name: NF5552_low_18
Description: NF5552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5552_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 35443714 - 35443916
Alignment:
| Q |
16 |
gtatgcattgttcctgatccttttttgattgtaaatatatgtatttgcttgctcgattgggtaaattttcgnnnnnnntttaaaggacatacactaacac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
35443714 |
gtatgcattgttcctgatccttttttgattgtaaatatatgtatttgcttgctcgattgggtaaatttttgaaaaaaatttaatggacatacactaacac |
35443813 |
T |
 |
| Q |
116 |
accgtagattagttttatatctgacattcaatagaaaccctaa-nnnnnnnnnccatgttatattgattttataatttactccctccgaccttaaacata |
214 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
35443814 |
accgtagattagttttatacccgacattcaatagaaaccctaattttttttttccatgttatattgattttataatgtactccctccgaccttaaatata |
35443913 |
T |
 |
| Q |
215 |
agt |
217 |
Q |
| |
|
||| |
|
|
| T |
35443914 |
agt |
35443916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University