View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5552_low_8 (Length: 330)
Name: NF5552_low_8
Description: NF5552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5552_low_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 31479315 - 31478982
Alignment:
| Q |
1 |
tctccttctttggggtcctttgctctatgataaattaactaattgccaatgtgaagtgtgaactacttatttggcatcatttgcggactatgctttattg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479315 |
tctccttctttggggtcctttgctgtatgataaatcaactaattgccaatgcgaa-------ctacttatttggcatcatttgcggactatgctttattt |
31479223 |
T |
 |
| Q |
101 |
tttttaccatgtacat----------tatgtaaattttagatactctaaattttagttggataccatgggtaccacatataaaannnnnnnnnnnnnnnn |
190 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479222 |
tttttaccatggacataatcaagatttatgtaaattttagatactctaaattttagttggataccatgggtaccacatataaaattttatttttattttt |
31479123 |
T |
 |
| Q |
191 |
-aaatgagtttatatgaaaatatgtcatatcgttgaataaatcgatgatcggtacattctcaactaacttcatagatatcactatcttcgtcaaagattt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479122 |
taaatgagtttatatgaaaatatgtcatatcgttgaataaatcgatgattggtacattctcaacaaacttcatagatatcactatcttcgtcaaagattt |
31479023 |
T |
 |
| Q |
290 |
atcaaggtgaacttagttttgatactttttacattattgta |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479022 |
atcaaggtgaacttagttttgatactttttacattattgta |
31478982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University