View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5553-Insertion-6 (Length: 147)
Name: NF5553-Insertion-6
Description: NF5553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5553-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 3e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 8 - 147
Target Start/End: Complemental strand, 34279616 - 34279477
Alignment:
| Q |
8 |
tagagaccttactaaacttattggattggttgattcctcttttcaagtatactttttgtcacattctttgtcaattggtttatagatactcattaattat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34279616 |
tagagaccttactaaacttattggattggttgattcctcttttcaagtatactttttgtcacattctttgtcaattggtttatagatactcattaattat |
34279517 |
T |
|
| Q |
108 |
gattcttgtcatatttgttgtaaaatatgacaatatgtgc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34279516 |
gattcttgtcatatttgttgtaaaatatgacattatgtgc |
34279477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University