View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5553-Insertion-7 (Length: 390)
Name: NF5553-Insertion-7
Description: NF5553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5553-Insertion-7 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 6e-59; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 250 - 390
Target Start/End: Complemental strand, 21070583 - 21070443
Alignment:
| Q |
250 |
cccatctttccaaaaatttatcaaacccnnnnnnntcacaaattcacaagaacaacaatgagaaagcttcaacaagcttcaataagaaccagatatgact |
349 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21070583 |
cccatctttccaaaaatttatcaaacccaaaaaaatcacaaattcacaagaacaacaatgagaaagcttcaacaagcttcaataagaaccagatctgact |
21070484 |
T |
|
| Q |
350 |
ctcacaatttcatccctaacctttcaatgtcatcgattcat |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21070483 |
ctcacaatttcatccctaacctttcaatgtcatcgattcat |
21070443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 11 - 136
Target Start/End: Complemental strand, 21070804 - 21070679
Alignment:
| Q |
11 |
tccttcgcttgaacttgtcagtagaatctgctgacgtggcatgctgattgtacaannnnnnnacttttattattnnnnnnnttccatgtggcttttctat |
110 |
Q |
| |
|
|||||| |||||| |||| |||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
21070804 |
tccttcacttgaatttgtgagtagaatctgctgacgtggcatgctgactgtacaatttttttacttttattattaaaaaaattccatgtggcttttctat |
21070705 |
T |
|
| Q |
111 |
gatttatgcttattaaaattaaaata |
136 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21070704 |
gatttatgcttattaaaattaaaata |
21070679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 48
Target Start/End: Original strand, 21069625 - 21069662
Alignment:
| Q |
11 |
tccttcgcttgaacttgtcagtagaatctgctgacgtg |
48 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
21069625 |
tccttcacttgaacttgtcagcagaatctgctgacgtg |
21069662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 26271155 - 26271107
Alignment:
| Q |
9 |
gatccttcgcttgaacttgtcagtagaatctgctgacgtggcatgctga |
57 |
Q |
| |
|
||||| || |||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
26271155 |
gatccctcacttgaacttgtcagcagaatctgctgacgtgtcatgctga |
26271107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 26266532 - 26266574
Alignment:
| Q |
18 |
cttgaacttgtcagtagaatctgctgacgtggcatgctgattg |
60 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||| |||||| |
|
|
| T |
26266532 |
cttgaacttgtcagcagaatctgctgacgtgtcatgttgattg |
26266574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 25 - 61
Target Start/End: Original strand, 3424899 - 3424935
Alignment:
| Q |
25 |
ttgtcagtagaatctgctgacgtggcatgctgattgt |
61 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
3424899 |
ttgtcagcagaatctgctgacgtggcatgttgattgt |
3424935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University