View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5553_high_11 (Length: 265)
Name: NF5553_high_11
Description: NF5553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5553_high_11 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 50 - 248
Target Start/End: Complemental strand, 144657 - 144459
Alignment:
| Q |
50 |
agcttccatattctcccactcactctccttccccttaagctgctccgccgcaggagccgaagcggaaccaccggcggtcgaagaattcgcggcggcggag |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
144657 |
agcttccatattctcccactcactctccttccccttaagctgctccgccgcgggagcagaagcggaaccaccggcggtcgaagaattcgcggcggcggag |
144558 |
T |
|
| Q |
150 |
gtattgttagggatttgaatatgaatatggatatttgttattagatcatggttttttgtgttgcagtaggaggaaagtgttcttggaggcgtgaaccat |
248 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
144557 |
gaattgttagggatttgaatttgaatatggatatttgttattagatcatggttttttgtgttgcagtaggaggaaagtattcttggaggcgtgaaccat |
144459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 27 - 100
Target Start/End: Complemental strand, 26259057 - 26258984
Alignment:
| Q |
27 |
gctttgaattccgcttcaatctcagcttccatattctcccactcactctccttccccttaagctgctccgccgc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26259057 |
gctttgaattccgcttcaatttcagcttccatactctcccactcactctccttcttcttaagctgctccgccgc |
26258984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 102 - 167
Target Start/End: Complemental strand, 26258940 - 26258875
Alignment:
| Q |
102 |
ggagccgaagcggaaccaccggcggtcgaagaattcgcggcggcggaggtattgttagggatttga |
167 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26258940 |
ggagcagaagcagaaccaccagcggtcgaagaattcgcggcggcggaggaattgttagggatttga |
26258875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University