View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5553_high_5 (Length: 328)
Name: NF5553_high_5
Description: NF5553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5553_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 13 - 312
Target Start/End: Original strand, 37087701 - 37088000
Alignment:
| Q |
13 |
catcaatgcattcaagcaagtggcaaacagttatcacttctctttgcagcactttatacaatagctttaggtggtggaggaataaaatccaatgtgtcag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37087701 |
catcaatgcattcaagcaagtggcaaacagttatcacttctctttgcagcactttatacaatagctttaggtggtggaggaataaaatccaatgtgtcag |
37087800 |
T |
 |
| Q |
113 |
gatttggatctgatcaatttgacacaaatgatccaaaggaagagaagaatatgatatttttcttcaatagattctacttttttataagtattggatcctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37087801 |
gatttggatctgatcaatttgacacaaatgatccaaaggaagagaagaatatgatatttttcttcaatagattctacttttttataagtattggatcctt |
37087900 |
T |
 |
| Q |
213 |
attttcagtggttgtattggtttatgttcaagacaatataggaagaggttggggatatggaatttcagcagggacaatgttggtagcagttggtattttg |
312 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37087901 |
gttttcagttgttgtattggtttatgttcaagacaatataggaagaggttggggatatggaatttcagcagggacaatgttggtagcagttggtattttg |
37088000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University