View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5553_low_16 (Length: 239)
Name: NF5553_low_16
Description: NF5553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5553_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 994385 - 994615
Alignment:
| Q |
1 |
ctcttgaaaggaagattaaggttcaatggttctttcgtcctagtgaggtttcaaagtgtttgacttggattaagatttattttaatgaattgttctttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
994385 |
ctcttgaaaggaagattaaggttcaatggttctttcgtcctattgaggtttcaaagtgtttgacttggattaagatttattttaatgaattgttctttgc |
994484 |
T |
 |
| Q |
101 |
ttgtggtgatggtgatggacttgctactattcatcctctggtaattcacccttttattctattttttgtgtgtatcaa---------agaagttgagtgc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
994485 |
ttgtggtgatggtgatggacttgctactattcatcctctggtaattcacccttttattctattttttgtgtgtatcaattttctctgagaagttgagtgc |
994584 |
T |
 |
| Q |
192 |
catcgagtaagttttagatcaatgcaatttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
994585 |
catcgagtaagttttagatcaatgcaatttt |
994615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University