View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5554-Insertion-5 (Length: 559)
Name: NF5554-Insertion-5
Description: NF5554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5554-Insertion-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 2e-78; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 8 - 185
Target Start/End: Complemental strand, 52380739 - 52380556
Alignment:
| Q |
8 |
aaagataaattagtatgatagtgatcactgtgcaa------aaacaaaatcagtaggggacgaaagtgtacctgagcggcgaatagagagcgtgtgagta |
101 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52380739 |
aaagataaattagtatgatcgtgatcactgtgcaactgcaaaaacaaaatcagtaggggaagaaagcgtacctgagcggcgaatagagagcgtgtgagta |
52380640 |
T |
|
| Q |
102 |
aggaattggtacgaagcaaactcgccatagaagtttagtaactatgcgggttcaaaggttactccttaggtgttgattacacag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380639 |
aggaattggtacgaagcaaactcgccatagaagtttagtaactatgcgggttcaaaggttactccttaggtgttgattacacag |
52380556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 108; E-Value: 6e-54
Query Start/End: Original strand, 428 - 543
Target Start/End: Complemental strand, 52380322 - 52380207
Alignment:
| Q |
428 |
gagaagactgcactacttaatgggccgggcttgtcattttcactaatgggtacccggtactttttatcaaattaataggctattacttttcccacctatg |
527 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52380322 |
gagaagactgcactacttaatgggccgggcttgtcattttcactaatgggtacccggtactttttatcaaattaatagactattacttttcccacctatg |
52380223 |
T |
|
| Q |
528 |
cttttctcatgcatcc |
543 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
52380222 |
cttttctcacgcatcc |
52380207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 251 - 342
Target Start/End: Complemental strand, 52380490 - 52380399
Alignment:
| Q |
251 |
ttatgttgatgcatgtcagaagtgaagaagtgttatattgattgattgattgattggggtttatgattctacggggggtttgatttccctcc |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380490 |
ttatgttgatgcatgtcagaagtgaagaagtgttatattgattgattgattgattagggtttatgattctacggggggtttgatttccctcc |
52380399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University