View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5554-Insertion-8 (Length: 112)
Name: NF5554-Insertion-8
Description: NF5554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5554-Insertion-8 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 7 - 112
Target Start/End: Complemental strand, 7978351 - 7978246
Alignment:
| Q |
7 |
agtctagataaaggaaaacaagaaaatgtagaatatggatataaggcacatagtacagcaggaacagtctttgacttctttaatgcacttggcactattg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7978351 |
agtctagataaaggaaaacaagaaaatgtacaatatggatataaggcacatagtacagcaggaacagtctttgacttctttaatgcacttggcactattg |
7978252 |
T |
 |
| Q |
107 |
cttttg |
112 |
Q |
| |
|
|||||| |
|
|
| T |
7978251 |
cttttg |
7978246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University