View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5554-Insertion-9 (Length: 178)
Name: NF5554-Insertion-9
Description: NF5554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5554-Insertion-9 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 143711 - 143863
Alignment:
| Q |
8 |
tgtgctgcttataactttttagctacacatgttaactcctatggtagatcaaagggcggacctggctctttatggcaggcggtgtggtcctggtttgggg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| || ||| |
|
|
| T |
143711 |
tgtgctgcttataactttttagctacacaggttaactcctatagtagatcaaagggcggacctggctctttatggcaggcggtgcggtcctggcttaggg |
143810 |
T |
|
| Q |
108 |
tgtcgggaccgaatactgacatcgttttcgatcacttttatcagttcagtcat |
160 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
143811 |
tgtcgggaccgaatactgacatcattttcgatcacttttattagttcagtcat |
143863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 70 - 160
Target Start/End: Original strand, 13889485 - 13889575
Alignment:
| Q |
70 |
tggctctttatggcaggcggtgtggtcctggtttggggtgtcgggaccgaatactgacatcgttttcgatcacttttatcagttcagtcat |
160 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| ||||||| ||||||||| || |||||| | |||| ||||||||||||||||||| |||| |
|
|
| T |
13889485 |
tggctctttatggcaggcggtgcggtcttggcttggggtttcgggaccggattctgacagcattttagatcacttttatcagttcaatcat |
13889575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 70 - 160
Target Start/End: Original strand, 32323876 - 32323965
Alignment:
| Q |
70 |
tggctctttatggcaggcggtgtggtcctggtttggggtgtcgggaccgaatactgacatcgttttcgatcacttttatcagttcagtcat |
160 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||||||||| ||| ||||| | |||| ||| |||||||||||| ||||||| |
|
|
| T |
32323876 |
tggctctttatggcaggcggcgca-tcctggcttggggtgtcgggaccggatattgacaacattttagattacttttatcagtccagtcat |
32323965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University