View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5554_high_27 (Length: 227)
Name: NF5554_high_27
Description: NF5554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5554_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 32812516 - 32812318
Alignment:
| Q |
19 |
atgtcaacagcatatagtatagttgatgacctgttaggatcatacagtccagataacgctttgcatctccatagatgtgtggtgattacattaaaactag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32812516 |
atgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgcatctccatagatgtgtggtgattacattaaaactag |
32812417 |
T |
|
| Q |
119 |
tgacacgggcaatactattaacttttgctttttccttcagtttgttgatatttttagaggttaattgaaaaaccttaaagtcgagttcttctgatgatg |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32812416 |
tgacacgggcaatactattaatttttgctttttccttcagtttgttgatatttttagaggttaattgaaaaaccttaaagtcgagttcttctgaggatg |
32812318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University