View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5554_low_22 (Length: 289)
Name: NF5554_low_22
Description: NF5554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5554_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 9222957 - 9222847
Alignment:
| Q |
18 |
cctctgaacgccggtgtgaatatacaacacagcgaatttcttcttccctagcttcgggaaaatcctctcctccaaaaacttcttcagaacctcaacgcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222957 |
cctctgaacgccggtgtgaatatacaacacagcgaatttcttcttccctagcttcgggaaaatcctctcctccaaaaacttcttcagaacctcaacgcta |
9222858 |
T |
 |
| Q |
118 |
accaatcgcgc |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
9222857 |
accaatcgcgc |
9222847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 204 - 276
Target Start/End: Complemental strand, 9222769 - 9222697
Alignment:
| Q |
204 |
ctgaaatatatttttacctgggaagaattttccgataatgcggaggatcttgcggccatgcttatctctgcct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222769 |
ctgaaatatatttttacctgggaagaattttccgataatgcggaggatcttgcggccatgcttatctctgcct |
9222697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 51685052 - 51685011
Alignment:
| Q |
18 |
cctctgaacgccggtgtgaatatacaacacagcgaatttctt |
59 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||||||| |
|
|
| T |
51685052 |
cctctgaacaccggtgtgaatatacaacaccgcaaatttctt |
51685011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University