View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5554_low_25 (Length: 247)
Name: NF5554_low_25
Description: NF5554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5554_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 117
Target Start/End: Complemental strand, 4704186 - 4704074
Alignment:
| Q |
5 |
ttcaatatatactcttccacttatataaaaaacttgtttgtttagagcataagtaggtgaatatggttagtatctgtgagtttcaaaagattttgttcac |
104 |
Q |
| |
|
||||| ||||||| || ||||||| | | |||||||||| ||||| |||| |||||||||| | | | |||||||||||||| |||||||| ||||| | |
|
|
| T |
4704186 |
ttcaacatatacttttacacttatgttataaacttgtttatttagtgcatgagtaggtgaagagagatggtatctgtgagtttgaaaagattgtgttccc |
4704087 |
T |
 |
| Q |
105 |
tttccctccaatt |
117 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
4704086 |
tttccctcaaatt |
4704074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 195 - 233
Target Start/End: Complemental strand, 4703098 - 4703060
Alignment:
| Q |
195 |
agtaggagacaagttagctatactgtgctgaaatgttca |
233 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4703098 |
agtaggagagaagttagctatactgtgctgaaatgttca |
4703060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University