View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5554_low_26 (Length: 240)
Name: NF5554_low_26
Description: NF5554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5554_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 40008837 - 40009052
Alignment:
| Q |
1 |
tcatatagaatgcaccctccatgagcttgaataggatttccatcagtatccaaccaaattttcccagggtagtagtaattataactatcattctttcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40008837 |
tcatatagaatgcaccctccatgagcttgaataggatttccatcagtatccaaccaaattttcccagggtagtagtaattataactatcattctttcctt |
40008936 |
T |
|
| Q |
101 |
tccctatagtcttcattggatcaataacacttgttttatgaggaaagaaaacatgtctaagtgatgaatcttgatccaagaattcatcaaccaatggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40008937 |
tccctatagtcttcattggatcaa------ttgttttatgaggaaagaaaacatgtctaagtgatgaatcttgatccaagaattcatcaaccaatggtgt |
40009030 |
T |
|
| Q |
201 |
tattgatttgctttgaggtgac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40009031 |
tattgatttgctttgaggtgac |
40009052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 5350284 - 5350211
Alignment:
| Q |
1 |
tcatatagaatgcaccctccatgagcttgaataggatttccatcagtatccaaccaaattttcccagggtagta |
74 |
Q |
| |
|
||||| ||||||| ||||||||| ||||||||||||| ||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
5350284 |
tcatacagaatgccccctccatgggcttgaataggatgaccatcagtatccaaccacattctccccgggtagta |
5350211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University