View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5554_low_28 (Length: 227)

Name: NF5554_low_28
Description: NF5554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5554_low_28
NF5554_low_28
[»] chr7 (1 HSPs)
chr7 (19-217)||(32812318-32812516)


Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 32812516 - 32812318
Alignment:
19 atgtcaacagcatatagtatagttgatgacctgttaggatcatacagtccagataacgctttgcatctccatagatgtgtggtgattacattaaaactag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||    
32812516 atgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgcatctccatagatgtgtggtgattacattaaaactag 32812417  T
119 tgacacgggcaatactattaacttttgctttttccttcagtttgttgatatttttagaggttaattgaaaaaccttaaagtcgagttcttctgatgatg 217  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
32812416 tgacacgggcaatactattaatttttgctttttccttcagtttgttgatatttttagaggttaattgaaaaaccttaaagtcgagttcttctgaggatg 32812318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University