View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5555_low_1 (Length: 530)
Name: NF5555_low_1
Description: NF5555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5555_low_1 |
 | |
|
| [»] scaffold0140 (4 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 232; Significance: 1e-128; HSPs: 4)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 13 - 317
Target Start/End: Complemental strand, 37239 - 36933
Alignment:
| Q |
13 |
cagaacataagtggtccaaaggaagcaactcagaaccagccattgccac-atgactttattgatgacacaactcatgttattactggtttgttgaaatgt |
111 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| || | || |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37239 |
cagaacataagtggtctaaaggaagcaactcagaaccagccattgccaccatcaaatt-ttgatgacacaactgatgttattactggtttgttgaaatgt |
37141 |
T |
|
| Q |
112 |
caaaagaa-tattgcaaaagtt-caaggcaagaaggtcatgactgttgggggtccatcagagactcaagctgaagcaatgttgagagacctgaagatgct |
209 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37140 |
caaaagaaatattgcaaaagttacaaggcaagaaggtcatgactgttgggggtccatcagagagtcaagctgaagcaatgttgagagacctgaagatgct |
37041 |
T |
|
| Q |
210 |
tccaccagaggaactagagaaggttacaagggagttggtgacaggcctagtgaattggaatgagaatattcacaagaacaaccaagcaaaaggaactgat |
309 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37040 |
tccaccagaggaactagaaaaggttacaagggagttggtcacaggtctagtgaattggaatgagaatattcagaagaacaaccaagcaaaaggaactgat |
36941 |
T |
|
| Q |
310 |
ggggagga |
317 |
Q |
| |
|
||| |||| |
|
|
| T |
36940 |
gggaagga |
36933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 388 - 466
Target Start/End: Complemental strand, 36900 - 36822
Alignment:
| Q |
388 |
ttaatgtttaagttttactttactttttggctatgaacctattagttgcactatgatgcttatgttgaaactgtaattt |
466 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36900 |
ttaatgtttaagttttactttactttttggctatgaacctattagttgcactatgatgcttatgttgaaactgtaattt |
36822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 48
Target Start/End: Complemental strand, 37264 - 37234
Alignment:
| Q |
18 |
cataagtggtccaaaggaagcaactcagaac |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37264 |
cataagtggtccaaaggaagcaactcagaac |
37234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 484 - 512
Target Start/End: Complemental strand, 36799 - 36771
Alignment:
| Q |
484 |
ggatgttttggtgctattggacctgttat |
512 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36799 |
ggatgttttggtgctattggacctgttat |
36771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University