View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5555_low_6 (Length: 263)
Name: NF5555_low_6
Description: NF5555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5555_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 14288758 - 14288533
Alignment:
| Q |
18 |
atattatacaccctttcacgtaatgtcaagcaattagaatagaaatcaacctcttatgtgatgttcaacatttaccacgctgcttattttcatctcaact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14288758 |
atattatacaccctttcacgtaatgtcaagcaattagaa-----atcaatctcttatgtgatgttcaacatttaccacgctgcttattttcatctcaact |
14288664 |
T |
 |
| Q |
118 |
tttaacacatcttcatctttctgtttgtcgtcctaaccgtcatgatgtcactttattcccaaattctctaaatatgccagcattaaccaaattatctcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14288663 |
tttaacacatcttcatctttctgtttgtcgtcctaatcgtgatgatatcactttattcccaaattctctaaatatgccagcattaaccaaattatctcta |
14288564 |
T |
 |
| Q |
218 |
cggaactttgtcttttgtgtcggagatgatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14288563 |
cggaactttgtcttttgtgtcggagatgatg |
14288533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University