View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5555_low_8 (Length: 204)
Name: NF5555_low_8
Description: NF5555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5555_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 47112416 - 47112584
Alignment:
| Q |
18 |
aattgaagaattgaaccatcagtagttcataataatcatcaccatatgcttgtgagcttcattttcacatagcgcatgatgtatgtattgttgtaatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47112416 |
aattgaagaattgaaccatcagtagttcataataatcatcaccatatgcttgtgagcttcattttcacatagcgcatgatgtatgtattgttgtaatttg |
47112515 |
T |
 |
| Q |
118 |
tgattggtatgtgacagatagagaatgctcgacattggacatatagttgtaattgcgacggtgacagaa |
186 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47112516 |
tgattggtatgtgacagatagagcatggtcgacattgggcatatagttgtaattgcgacggtgacagaa |
47112584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University