View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5556_high_7 (Length: 393)
Name: NF5556_high_7
Description: NF5556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5556_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 16 - 306
Target Start/End: Complemental strand, 29125692 - 29125400
Alignment:
| Q |
16 |
caagaagctaaattatgcgttatgatcctgaattattagtgaatcgagcaaaaccctnnnnnnnn--gtgagaattggaagagtgaaagcaacctgaaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29125692 |
caagaagctaaattatgcgttatgatcctgaattattagtgaatcgagcaaaaccctaaaaaaaaaagtgagaattggaagagtgaaagcaacctgaaaa |
29125593 |
T |
 |
| Q |
114 |
gtatgagctggcaattgccagccatgttttctgaccatgtctgactgtgtactctgaagtgaagttgctttggagaagaatacagatttacactgacagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29125592 |
gtatgagctggcaattgccagccatgttttctgaccatgtctgactgtgtactctgaagtgaagttgctttggagaagaatacagatttacactgacagt |
29125493 |
T |
 |
| Q |
214 |
gtgtgtcactctctcgtcgtctcgttctaaaaagcttttaactaccaaacaaccgcactcagttgctttctatttccagctgcacaaagactc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29125492 |
gtgtgtcactctctcgtcgtctcgttctaaaaagcttttaactaccaaacaaccgcactcagttgctttctatttccagctgcacaaagactc |
29125400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University