View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5556_low_15 (Length: 302)

Name: NF5556_low_15
Description: NF5556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5556_low_15
NF5556_low_15
[»] chr4 (1 HSPs)
chr4 (1-289)||(52087400-52087688)


Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 52087400 - 52087688
Alignment:
1 atgttgtagaaccaagtcgttatcgtgaacctcggtgacccaattaagagccatggtttcatcaactataggcttgttatctttgatgactgccaagtgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52087400 atgttgtagaaccaagtcgttatcgtgaacctcggtgacccaattaagagccatggtttcatcaactataggcttgttatctttgatgactgccaagtgt 52087499  T
101 gtagggtgcactgcataggcatggagatcttccttggatctgaatctactatggatcatgtgagtgaaattgaaagatgaaatggaattggaggattgaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52087500 gtagggtgcactgcataggcatggagatcttccttggatctgaatctactatggatcatgtgagtgaaattgaaagatgaaatggaattggaggattgaa 52087599  T
201 tacttaccaacggacccatagtcaagtgaagtggctcttcaagagagataagggaattcacttgcttcaccatggaatcaatcgctgat 289  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52087600 tacttaccaacggacccatagttaagtgaagtggctcttcaagagagataagggaattcacttgcttcaccatggaatcaatcgctgat 52087688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University