View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5556_low_20 (Length: 251)
Name: NF5556_low_20
Description: NF5556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5556_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 13 - 244
Target Start/End: Complemental strand, 37294021 - 37293800
Alignment:
| Q |
13 |
aatatcgtaatcaatcgttaaattagttcagtgtcattgtagtgacctaacacaactgtatatgttttgtgacatacannnnnnnctaatgaaaatttct |
112 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
37294021 |
aatatcgtaatcaatcgtcaaattagttcagtgtcattgtagtgacctaacacaactgtatatgttttgtgacatccatttttttctaatgaaaatttct |
37293922 |
T |
|
| Q |
113 |
tatataacatttcaacggatgaacttcgaatataaaagtcacaaccactgcaagtaaatggtctgccatctatgcaatatattaattgattgataaagaa |
212 |
Q |
| |
|
||| |||| ||||||||||||||||| |||||||||| ||||||| |||||| ||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
37293921 |
tatgtaacctttcaacggatgaactttgaatataaaactcacaactactgcaggtaaatggtctgcca----------atatttattgattgataaagaa |
37293832 |
T |
|
| Q |
213 |
atatcaatgcgacaaatatctattattatttt |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
37293831 |
atatcaatgcgacaaatatctattattttttt |
37293800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University