View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5556_low_21 (Length: 251)
Name: NF5556_low_21
Description: NF5556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5556_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 4 - 244
Target Start/End: Complemental strand, 15676845 - 15676605
Alignment:
| Q |
4 |
atgtcgaagaatatataaatgagattgctcgtatacaaatatcttaattttttggttaagatatgatatccaattccaccttatgtagttattaaagcca |
103 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| || |
|
|
| T |
15676845 |
atgttgaacaatatataaatgagattactcatatacaaatatcttaattttttggttaagatataatatccaattgcaccttatgtagttattaaagtca |
15676746 |
T |
 |
| Q |
104 |
aatgtatccattagacttctctatgatccaacattgatatcagatccgatgatcacatggactccttgtatcgaaagtcattataataacaatggtgata |
203 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15676745 |
aatgtatccatcagacttctctatgacccaacattgatatcagacccgatgatcatatggactccttgtatcgaaagtcattataataacaatggtgata |
15676646 |
T |
 |
| Q |
204 |
taacgtttggttgatggagaatcaaagacgatggatatatt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15676645 |
taacgtttggttgatggagaatcaaagacgatggatatatt |
15676605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University