View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5556_low_6 (Length: 435)
Name: NF5556_low_6
Description: NF5556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5556_low_6 |
 | |
|
| [»] scaffold0004 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0004 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 81652 - 81953
Alignment:
| Q |
1 |
gatgctgctcaagtttttctcaaaaggagagggtcaaggacagtatgaatggaatgcaacagaagaatcaaatatataatgactccgatgaaactagcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81652 |
gatgctgctcaagtttttctcaaaaggagagggtcaaggacagtatgaatggaatgcaacagaagaatcaaatatataatgactccgatgaaactagcga |
81751 |
T |
|
| Q |
101 |
ctaaagctcctgtcatgtgattgcaaaatttgggaactgaaccacaaatcggtagccaagcagcataattgtttccattctttgccacttgagctatagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81752 |
ctaaagctcctgtcatgtgattgcaaaatttgggaactgaaccacaaatcggtagccaagcagcataattgtttccattctttgccacttgagctatagc |
81851 |
T |
|
| Q |
201 |
caaagctgcagagatgcttgagataagtaacattgtcaacacctgctcataaaaatcaattaaagcaataagtaatattgtagttccataaccataatta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81852 |
caaagctgcagagatgcttgagataagtaacattgtcaacacctgctcagaaaaatcaattaaagcaataagtaatattgtagttccataaccataatta |
81951 |
T |
|
| Q |
301 |
gt |
302 |
Q |
| |
|
|| |
|
|
| T |
81952 |
gt |
81953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 349 - 429
Target Start/End: Original strand, 82000 - 82080
Alignment:
| Q |
349 |
aacacgtcaaacaataaacttggatacatctctcagccaaaaaatcatacattggttagtcacacattgggagtataatct |
429 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82000 |
aacacgtcaaacaataaacttggatacatctctcagccaaaaaatcatacattggttagtcacacattgggagtataatct |
82080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University