View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5557-Insertion-8 (Length: 292)
Name: NF5557-Insertion-8
Description: NF5557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5557-Insertion-8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 46 - 178
Target Start/End: Complemental strand, 48311168 - 48311036
Alignment:
| Q |
46 |
atcaactgcatctattcctaaggttggttttgttggttggtatttggggatgataaaatcacgccctattctcactaaaagtgttacctctgcactcatt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48311168 |
atcaactgcatctattcctaaggttggttttgttggttggtatttggggatgataaaatcacgccctattctcactaaaagtgttacctctgcactcatt |
48311069 |
T |
 |
| Q |
146 |
tatactgctgctgatttatcctctcaggtaccc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48311068 |
tatactgctgctgatttatcctctcaggtaccc |
48311036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 216 - 292
Target Start/End: Complemental strand, 48310998 - 48310923
Alignment:
| Q |
216 |
cttgtctgcattcattggtttgggttcaaaaggaacattttttagttgatgtttgttataattgttcacttggttgt |
292 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48310998 |
cttgtctgcattcattgatttgggttcaaaaggaac-ttttttagttgatgtttgttacaattgttcacttggttgt |
48310923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University