View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5557_high_20 (Length: 270)
Name: NF5557_high_20
Description: NF5557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5557_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 53 - 262
Target Start/End: Complemental strand, 10148574 - 10148360
Alignment:
| Q |
53 |
gaaaattgatgtaaatctcctaacttctccaatgaaatttcaattttatccatccattatttatgccaaagaaaaaagtaaaaactatatgatgcttctt |
152 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10148574 |
gaaaattgatgtaaatctcctaacttttccaatgaaatttcaattttatccatccattatttatgccaaagaaaaaagtaacaactatatgatgcttctt |
10148475 |
T |
|
| Q |
153 |
tcccgt----nnnnnnnnnctatatgctgcttcttattcatcannnnnnnnnnnnaactatatgatgcattgatgcttcttta----tatacgtcagtct |
244 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
10148474 |
tcccgtaaaaaaaaaaaaactatatgctgcttcttattcatca---tttttttttaactatatcatgcattgatgcttctttatatgtatacgtcagtct |
10148378 |
T |
|
| Q |
245 |
tttggtgtgagtataatc |
262 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10148377 |
tttggtgtgagtataatc |
10148360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 38
Target Start/End: Complemental strand, 10148593 - 10148560
Alignment:
| Q |
5 |
aaacactttaactcatcaagaaaattgatgtaaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10148593 |
aaacactttaactcatcaagaaaattgatgtaaa |
10148560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University