View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5557_high_30 (Length: 241)
Name: NF5557_high_30
Description: NF5557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5557_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 44305751 - 44305538
Alignment:
| Q |
13 |
aagaatatctgtgtgattcaaagtttgacggttagtgtaaatgccaggttat---gtccccatactaaagaagcaaaatgggattaagataatttagagg |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44305751 |
aagaatatctatgtgattcaaagtttgacggttagtgtaaatgccaggttattatgtccccatactaaagaagcaaaatgggattaagataatttagagg |
44305652 |
T |
 |
| Q |
110 |
caaatgaagatttgttcattttatttttgttatttgttgttaatactaattctgatgattgcttttatttgtctcagcttgcttgcaatgtttttaaata |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
44305651 |
caaatgaagatttgttctttttatttttgttatttgttgttaatactaattctgatgattgcttttatttgtcgcagcttacttgcaatgtttttaaata |
44305552 |
T |
 |
| Q |
210 |
gcagcgctatagct |
223 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
44305551 |
gcagcgatatagct |
44305538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 43895327 - 43895117
Alignment:
| Q |
13 |
aagaatatctgtgtgattcaaagtttgacggttagtgtaaatgccaggttat---gtccccatactaaagaagcaaaatgggattaagataatttagagg |
109 |
Q |
| |
|
|||||||||| || |||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43895327 |
aagaatatctatgcgattcaaagtttgacggtcagtgtaaatgccaggttattatgtccccatactaaag---caaaatgggattaagataatttagagg |
43895231 |
T |
 |
| Q |
110 |
caaatgaagatttgttcattttatttttgttatttgttgttaatactaattctgatgattgcttttatttgtctcagcttgcttgcaatgtttttaaata |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43895230 |
caaatgaagatttgttctttttatttttgttatttgttgttaatactaattctgatgattgcttttatctgtctcagcttgcttgcaatgtttttaaata |
43895131 |
T |
 |
| Q |
210 |
gcagcgctatagct |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43895130 |
gcagcgctatagct |
43895117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University