View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5557_low_21 (Length: 267)
Name: NF5557_low_21
Description: NF5557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5557_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 37520158 - 37519900
Alignment:
| Q |
1 |
ccaacattgatagggagcagagtaacaacactgcacctgcagcaccagatcatgaagctaatggtaataacagttataaggaaaattaccaaagggacca |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37520158 |
ccaacattgatagggagcagaataacaacactgcacctgcagcaccagatcatgaagctaatggtaataacagttataaggaaaattaccaaagggacca |
37520059 |
T |
 |
| Q |
101 |
gtttgatgatttcattcagattgctaagnnnnnnntgagagcttcatcaagcattcgaaacaacagtttcttgaagaagccatgataattggtgatcctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37520058 |
gtttgatgatttcattcagattgctaagaaaaaaatgagagcttcatcaagcattcgaaacaacagtttcttgaagaagccatgataattggtgatcctc |
37519959 |
T |
 |
| Q |
201 |
aaagattatatgagttagcaacgtttggtgttgacttggcgttgactatgtcctatgct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37519958 |
aaagattatatgagttagcaacgtttggtgttgacttggcgttgactatgttctatgct |
37519900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University