View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5558-Insertion-9 (Length: 110)
Name: NF5558-Insertion-9
Description: NF5558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5558-Insertion-9 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0002 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 13 - 110
Target Start/End: Original strand, 437805 - 437902
Alignment:
| Q |
13 |
tacaatagatagtatcccttgtgcttcagcatgacttgaggcgtctactatttcagcattatcaaacaggagcatccgaacaactgataattgggttc |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
437805 |
tacaatagatagtatcccttgtggttcagcatgacttgaggtgtctactatttcagcattatcaaacaggagcatccgaaccactgataattgggttc |
437902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 93
Target Start/End: Complemental strand, 28609099 - 28609019
Alignment:
| Q |
13 |
tacaatagatagtatcccttgtgcttcagcatgacttgaggcgtctactatttcagcattatcaaacaggagcatccgaac |
93 |
Q |
| |
|
||||||||||| ||| || ||||| | ||||||||| || ||| |||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
28609099 |
tacaatagataatatgccccttgctttatcatgacttgtggtgtccactattgcagctttaccaaacaggagcatccgaac |
28609019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University