View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5558_high_20 (Length: 243)
Name: NF5558_high_20
Description: NF5558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5558_high_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 38524333 - 38524555
Alignment:
| Q |
19 |
ctatcgtatagttttagtggcatacacctgatactcatatcatgttggtgtaactct--tgcataaattaccgtagagttacttagttgatgtatcaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38524333 |
ctatcgtatagttttagtggcatacacctgatactcat--catgttggtgtaactctgttgcataaattacc--agagttacttagttgatgtatcaaat |
38524428 |
T |
|
| Q |
117 |
tctcttattgattacaatttgtgtatgaatattttctatatgttaatgtcaattacctttgtgctgtacccataattaatggcaatattttcagtccttc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38524429 |
tctcttattgattacaatttgtgtatgaatattttctatctgtcaatgtcaattacctttgtgctgtacccataattaatggcaatattttcagtccttc |
38524528 |
T |
|
| Q |
217 |
cttttactaaaaaacactgcaatattt |
243 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
38524529 |
cttttactaaaaaacactgcattattt |
38524555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University