View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5558_low_18 (Length: 256)
Name: NF5558_low_18
Description: NF5558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5558_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 15 - 256
Target Start/End: Original strand, 47314821 - 47315044
Alignment:
| Q |
15 |
caaaggtatagtgtttttaacaatcatggataattcttccacgtagtgtttttatttatgtactatgagagcatttttcaaagtgttcatggtttatggg |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47314821 |
caaaggtatagtgtttttaacaatcgtggataattcttccacgtagtgtttttatttatgtactatgagagcatttttgaaagtgttcatggtttat--- |
47314917 |
T |
 |
| Q |
115 |
ggtataggatgttatgggtacggatcaacccacaaacccgctcacccaaaccaacccacattttaaccaaacacaatcaactcattcaaactcaatatgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47314918 |
---------------gggtacggatcaacccacaaacccgctcacccaaaccaacccacattttaaccaaacacaatcaactcattcaaactcaatatgt |
47315002 |
T |
 |
| Q |
215 |
ttggtttggatggtggatttgccattttgaacccgcaaagtt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47315003 |
ttggtttggatggtggatttgccattttgaacccgcaaagtt |
47315044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University