View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5558_low_20 (Length: 245)
Name: NF5558_low_20
Description: NF5558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5558_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 176 - 232
Target Start/End: Original strand, 4098854 - 4098910
Alignment:
| Q |
176 |
cctaaaattggttgttcttaaagcttattaggtcatacaacacctaaacctagattt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4098854 |
cctaaaattggttgttcttaaagcttattaggtcatacaacacctaaacctagattt |
4098910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 4098727 - 4098771
Alignment:
| Q |
17 |
ataatttatgtagagttcttggaactaaataaacacatcgcacat |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4098727 |
ataatttatgtagagttcttggaactaaataaacacatcgcacat |
4098771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 232
Target Start/End: Original strand, 20546661 - 20546706
Alignment:
| Q |
187 |
ttgttcttaaagcttattaggtcatacaacacctaaacctagattt |
232 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
20546661 |
ttgttcttaaaatttattaggtcatgcaacacctaaatctagattt |
20546706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University