View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5558_low_22 (Length: 242)
Name: NF5558_low_22
Description: NF5558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5558_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 114 - 241
Target Start/End: Complemental strand, 48187848 - 48187721
Alignment:
| Q |
114 |
aaacttgtttgaaattattttaattaaataaattgcatatatagtctttatttttactcatcaaagtgtatttaaaatgttacccatataggtactctag |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48187848 |
aaacttgtttgaagttattttaattaaataaattgcatttatagtctttatttttactcatcaaagtgtatttaaaatgttacccatataggtactctag |
48187749 |
T |
 |
| Q |
214 |
ttaaagaaattgagtagtcaatagcata |
241 |
Q |
| |
|
||||||| ||||||||||||||| |||| |
|
|
| T |
48187748 |
ttaaagatattgagtagtcaataacata |
48187721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University