View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5558_low_23 (Length: 242)
Name: NF5558_low_23
Description: NF5558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5558_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 47315095 - 47315317
Alignment:
| Q |
1 |
cacattcttgaccataaatctatttctttattatagtatagtttttattaattgtaaaaaccaaagcacatatctaatgtgagagatttctgacttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47315095 |
cacattcttgaccataaatctatttctttattatagtatagtttttattaattgtaaaaaccaaagcacatatctaatgtgagagatttctgacttttat |
47315194 |
T |
|
| Q |
101 |
tctaattgagagaactcttaccctttaacttttgttttagatgatgataattattattttannnnnnnnggacttgattcaaattgtggaagaattttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
47315195 |
tctaattgagagaactcttaccctttaacttttgttttagatgatgataatttttttttt---tttttttgacttgattcaaattgtggaagaattttta |
47315291 |
T |
|
| Q |
201 |
atcatttaatataaaatgcacaaggt |
226 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
47315292 |
atcatttaatataaaatgcataaggt |
47315317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 206
Target Start/End: Complemental strand, 35727693 - 35727657
Alignment:
| Q |
170 |
ggacttgattcaaattgtggaagaatttttaatcatt |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
35727693 |
ggactttattcaaattgtggaagaatttttaagcatt |
35727657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University